home *** CD-ROM | disk | FTP | other *** search
- Archive-name: biology/info-theory
-
- ***********************************************************
-
- Replies to Frequently Asked Questions (FAQ) for bionet.info-theory
-
- Biological Information Theory and Chowder Society
-
- version = 1.71 of bionet.info-theory.faq 1995 March 8
-
- ***********************************************************
- |-| What is the History of The Biological Information Theory and Chowder Society?
- |-| What Kind of Questions Are Appropriate For Discussion?
- |-| Is There a Quick Introduction to Information Theory Somewhere?
- |-| I'm Confused: How Could Information Equal Entropy?
- |-| How Can I Learn More About Information Theory and Biology? References
- |-| Will Authors Send Me Papers?
- |-| How Do I find Sequence Logos on the Web?
- |-| Is There a Shell Script for Making Sequence Logos?
- |-| Is There a Mosaic Page for Making Sequence Logos?
- |-| Can You Just Point My Mosaic To The FAQ and the Archives?
- |-| How Do I obtain bionet.info-theory BY EMAIL?
- |-| Where Did I Get This FAQ File From Originally?
- |-| What is the IP number of the FAQ archive?
- |-| Where Are the Bionet Archives?
- |-| What Can I Do About Inappropriate Postings?
- |-| What is the official word on copyright of this FAQ?
- |-| Who Takes Care of This Group?
- |-|
- ***********************************************************
-
- |-| What is the History of The Biological Information Theory and Chowder Society?
-
- The Biological Information Theory and Chowder Society (BITCS) is a group of
- scientists interested in the biological applications of information theory
- (thus the "BIT") who meet informally for dinner (thus the "CS") from time to
- time in the Washington, DC, area. At our dinners we have only one rule ---
- food fights are discouraged.
-
- The guys who started this thing did it because we weren't certain we understood
- the biological implications of information theory. Some of us are more
- comfortable with the mathematical machinery and assemble biological systems
- into grand canonical ensembles whether they want to be there or not; and some
- of us think they understand what the biological systems are doing but can't
- take a log to base 2. What we try to do is pry from one another the bits of
- knowledge that will help us understand what's going on.
-
- Some of the topics up for discussion in our group are:
- biological applications of information theory
- biochemical molecular machines
- computer methods for recognition of molecular structure and function
- database organization for biomolecular information
- nanotechnology
- the limits of computation
- "dissipationless" (?) computation
- Maxwell's demon
- anecdotes and humor about all these topics
- A few relevant papers are listed below.
-
- The group started when Tom Schneider was introduced to John Spouge in 1988.
- Tom bounced his ideas about molecular machines off John, and John kept finding
- flaws. Tom would go away rather unhappily for a month and then find a
- solution. But John was always one step ahead... (and still is, on last
- account.) Tom gave a talk about molecular machines at the Lambda Lunch meeting
- on the Bethesda NIH campus, and John introduced John (Steve) Garavelli. We all
- got together with Peter Basser for dinner once in a while to talk about
- information theory. Steve brought in one of the first people to apply
- information theory to biology, Hubert Yockey. Steve Garavelli dubbed the group
- the "Biological Information Theory and Chowder Society", which it is still
- called. We are known sometimes as 'chowderheads', and talk about food fights,
- but so far have only had electronic food fights! We hold dinners in Bethesda
- Maryland on random occasions.
-
- When our informal mailing list became difficult to handle, we petitioned to
- start a bionet news group. We hope to hold roaring discussions, and everyone
- is welcome to join. If you are uncertain about something, quit lurking and ask
- on the net. It may well be that what bothered you is the key to a new piece of
- information theory in biology. (The major advances so far have been by things
- that REALLY bugged people.)
-
- We will also announce when and where our (irregular) eatings are and you are
- welcome to join if the travel is not too far. John Spouge
- (spouge@ncbi.nlm.nih.gov), usually makes the arrangements.
-
- ***********************************************************
-
- |-| What Kind of Questions Are Appropriate For Discussion?
-
- This faq sheet answers simple questions about this group. The BIG questions
- should be discussed on the net, where we can all haggle over them. Here are a
- few for starters:
-
- What is the role of theory in biology today?
- What should be the role of biological theory?
-
- What is information? How should it be defined?
-
- What bothers you when you read the two papers on the theory of molecular
- machines? (It is only from the things that bother us that we can make progress
- in understanding.) (See references below.)
-
- What are flaws in the theory of molecular machines?
-
- How is ATP used to drive molecular machines?
-
- All communication systems are associated with living things, so is it true that
- information theory is really a theory about living things? Was Shannon really
- a great biologist?
-
- What does Maxwell's Demon have to do with all of this?
-
- What are the limits of computers?
-
- What are the limits of nanotechnology?
-
- ***********************************************************
-
- |-| Is There a Quick Introduction to Information Theory Somewhere?
-
- See the primer on information theory:
- ftp://ftp.ncifcrf.gov/pub/delila/primer.ps
-
- ***********************************************************
-
- |-| I'm Confused: How Could Information Equal Entropy?
-
- If someone says that information = uncertainty = entropy, then they are
- confused, or something was not stated that should have been. Those equalities
- lead to a contradiction, since entropy of a system increases as the system
- becomes more disordered. So information corresponds to disorder according to
- this confusion.
-
- If you always take information to be a decrease in uncertainty at the receiver
- and you will get straightened out:
-
- R = Hbefore - Hafter.
-
- where H is the Shannon uncertainty:
-
- H = - sum (from i = 1 to number of symbols) Pi log2 Pi (bits per symbol)
-
- and Pi is the probability of the ith symbol. If you don't understand this,
- please refer to "Is There a Quick Introduction to Information Theory
- Somewhere?".
-
- Imagine that we are in communication and that we have agreed on an alphabet.
- Before I send you a bunch of characters, you are uncertain (Hbefore) as to what
- I'm about to send. After you receive a character, your uncertainty goes down
- (to Hafter). Hafter is never zero because of noise in the communication
- system. Your decrease in uncertainty is the information (R) that you gain.
-
- Since Hbefore and Hafter are state functions, this makes R a function of
- state. It allows you to lose information (it's called forgetting). You can
- put information into a computer and then remove it in a cycle.
-
- Many of the statements in the early literature assumed a noisess channel, so
- the uncertainty after receipt is zero (Hafter=0). This leads to to the SPECIAL
- CASE where R = Hbefore. But Hbefore is NOT "the uncertainty", it is the
- uncertainty of the receiver BEFORE RECEIVING THE MESSAGE.
-
- A way to see this is to work out the information in a bunch of DNA binding
- sites. Here is an aligned listing of the binding sites for the cI and cro
- proteins of the bacteriophage (ie, virus) named lambda:
-
- alist 5.21 aligned listing of:
- * 92/10/04 23:17:10, 91/02/05 15:07:18, lambda.ci.cro
- The book is from: 0 to 0
- This alist list is from: -30 to 30
- The alignment is by delila instructions
-
- --------------------- +++++++++++++++++++++
- 322222222221111111111--------- +++++++++111111111122222222223
- 0987654321098765432109876543210123456789012345678901234567890
- .............................................................
- 1 tgcgtcctgctgatgtgctcagtatcaccgccagtggtatttatgtcaacaccgccagaga
- 2 tctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgca
- 3 tcaccgccagtggtatttatgtcaacaccgccagagataatttatcaccgcagatggttat
- 4 ataaccatctgcggtgataaattatctctggcggtgttgacataaataccactggcggtga
- 5 gtcaacaccgccagagataatttatcaccgcagatggttatctgtatgttttttatatgaa
- 6 ttcatataaaaaacatacagataaccatctgcggtgataaattatctctggcggtgttgac
- 7 ttttgtgctcatacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgtt
- 8 aacacgcacggtgttagatatttatcccttgcggtgatagatttaacgtatgagcacaaaa
- 9 atcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtga
- 10 tcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttatcccttgcggtgat
- 11 acaccgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggagg
- 12 cctccttagtacatgcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgt
- ^
-
- Read the numbers on the top vertically. This is called a "numbar". Notice
- that position +7 always has a T (marked with the ^). That is, according to
- this rather limited data set, one or both of the proteins that bind here always
- require a T at that spot. Since the frequency of T is 1 and the frequencies of
- other bases there are 0, H(+7) = 0 bits. But that makes no sense whatsoever!
- This is a position where the protein requires information to be there. That
- is, what is really happeneing is that the protein has two states. In the
- BEFORE state, it is somewhere on the DNA, and is able to probe all 4 possible
- bases. Thus the uncertainty before binding is Hbefore = log2(4) = 2 bits. In
- the AFTER state, the protein has bound and the uncertainty is lower:
- Hafter(+7) = 0 bits. The information content, or sequence conservation, of the
- position is Rsequence(+7) = Hbefore - Hafter = 2 bits. That is a sensible
- answer. Notice that this gives Rsequence close to zero outside the sites.
-
- If you have uncertainty and information and entropy confused, I don't think you
- would be able to work through this problem. For one thing, one would get high
- information OUTSIDE the sites. Some people have published graphs like this.
-
- A nice way to display binding site data so you can see them and grasp their
- meaning rapidly is by the sequence logo method.
-
- ***********************************************************
-
- |-| How Can I Learn More About Information Theory and Biology? References
-
- REFERENCES - General
-
- There are a huge number of papers related to this topic, just about everything
- in molecular biology, lots of chemistry, physics, electronics, evolutionary
- theory, thermodynamics, statistical mechanics and the kitchen sink ... You can
- get a pretty good overview by combining the references of Schneider.ccmm,
- Schneider.edmm and Leff1990. References are given in BiBTeX format, the
- bibliography program associated with LaTeX, the powerful and portable
- typesetting program.
-
- By arrangement, books that have prices listed can be ordered over Internet from:
- Reiter's Scientific & Professional Books
- 2021 K Street, NW
- Washington, DC 20006
- 1-800-537-4314
- 1-202-223-3327
- 1-202-296-9103 FAX
- books@reiters.com
-
- Shipping and handling charges are:
- in the DC metropolitan area $4.00 for one item, $0.50 for each additional item,
- outside the area $4.50 for one item, $0.50 for each additional item.
-
- The prices are current as of October 1994; because publishers are constantly
- changing their prices, they should be considered estimates rather than
- guaranteed prices. To open an account you must first either phone or FAX them
- and provide a credit card number. Book orders can be then placed at any time
- over the Internet.
- **DO NOT SEND CREDIT CARD NUMBERS OVER THE INTERNET!**
-
- Reiter's carries all of the books on this list except "Information Theory:
- Saving Bits", and that one can be special ordered. If enough interest in this
- book is generated by the FAQ, it will be added as regular stock. (It can also
- be ordered directly from the company using the information given.)
-
- # Gonick's Wonderful books (Don't be shy! They are worth the money!!):
-
- @book{Gonick.computers,
- author = "L. Gonick",
- title = "The Cartoon Guide to Computers",
- edition = "second",
- publisher = "HarperCollins",
- address = "New York, NY",
- isbn = "0-06-273097-5",
- price = "price as of 1994 October 31: \$11.00",
- year = "1991"}
-
- @book{Gonick.genetics,
- author = "L. Gonick",
- title = "The Cartoon Guide to Genetics",
- edition = "updated",
- publisher = "Barnes \& Nobel",
- address = "New York, NY",
- isbn = "0-06-273099-1",
- price = "price as of 1994 October 31: \$12.00",
- year = "1991"}
-
- @book{Gonick.physics,
- author = "L. Gonick
- and A. Huffman",
- title = "The Cartoon Guide to Physics",
- publisher = "HarperPerennial",
- address = "New York, NY",
- isbn = "0-06-273100-9",
- price = "price as of 1994 October 31: \$12.00",
- year = "1990"}
-
- # A good starting point if you don't know much molecular biology:
- # (Two volumes)
-
- @book{Watson1987,
- author = "J. D. Watson
- and N. H. Hopkins
- and J. W. Roberts
- and J. A. Steitz
- and A. M. Weiner",
- title = "Molecular Biology of the Gene",
- edition = "fourth",
- publisher = "The Benjamin/Cummings Publishing Co., Inc.",
- address = "Menlo Park, California",
- isbn = "0-8053-9614-4",
- price = "price as of 1994 October 31: \$59.95",
- year = "1987"}
-
- # This book describes LaTex and BiBTeX:
-
- @book{Lamport1994,
- author = "L. Lamport",
- title = "\LaTeX: A Document Preparation System,
- User's Guide \& Reference Manual",
- edition = "second",
- publisher = "Addison-Wesley Publishing Company",
- address = "Reading, Massachusetts",
- isbn = "0-201-52983-1",
- price = "price as of 1994 October 31: \$32.95",
- year = "1994"}
-
- # ***********************************************************
- # REFERENCES - Information Theory
-
- # The best starter book:
-
- @book{Pierce1980,
- author = "J. R. Pierce",
- title = "An Introduction to Information Theory:
- Symbols, Signals and Noise",
- edition = "second",
- publisher = "Dover Publications, Inc.",
- address = "New York",
- isbn = "0-486-24061-4",
- comment = "
- original copyright 1961
- Ordering information: Pierce1980 is currently available by mail from:
- Dover Publications, Inc.
- 31 East 2nd street
- Mineola, New York 11501
- order:
- Pierce, An Introduction to Information Theory: Symbols, Signals and Noise
- code number: 24061-4
- $7.95 + charges. Payment in full, no telephone or credit card orders.
- Postage and Handling charges are:
- Bookrate: $3 (US only)
- UPS: $4.50 (US only, not Alaska or Hawaii or PO boxes)
- Foreign orders: add 20% of total (minimum $2.50)
- Sales Tax (Ny residents only)
- Foreign Orders Note: Remittances must be sent by international money order or
- in U.S. funds via Federal Wire System to Chemical Bank, N. Y. ABA #021000128.
- Mark all remittances `For the account of Dover Publications, Inc. #001 053
- 272'. This information is from the Dover Math and Science Catalogue 9/92",
- price = "price as of 1994 October 31: \$8.95",
- year = "1980"}
-
- Christopher Hillman (hillman@math.washington.edu) suggests that this one is a
- better starting point: Thomas Cover and Joy A. Thomas, Elements of Information
- Theory, Wiley, 1991. People who have seen both could post their opinions.
-
- # A good introduction to the mathematics:
-
- @book{Sacco1988,
- author = "W. Sacco
- and W. Copes
- and C. Sloyer
- and R. Stark",
- title = "Information Theory: Saving Bits",
- publisher = "Janson Publications, Inc.",
- comment = "original address was Providence, Rhode Island",
- address = "Dedham, MA",
- isbn = "0-939765-25-X",
- phone = "(800) 322-6284",
- price = "price as of 1994 October 31: \$11.95",
- year = "1988"}
-
- # Important originals:
-
- @article{Shannon1948,
- author = "C. E. Shannon",
- title = "A Mathematical Theory of Communication",
- year = "1948",
- journal = "Bell System Tech. J.",
- volume = "27",
- pages = "379-423, 623-656"}
-
- @book{ShannonWeaver1949,
- author = "C. E. Shannon
- and W. Weaver",
- title = "The Mathematical Theory of Communication",
- publisher = "University of Illinois Press",
- address = "Urbana",
- isbn = "0-252-72548-4",
- price = "price as of 1994 October 31: \$9.95",
- year = "1949"}
-
- @article{Shannon1949,
- author = "C. E. Shannon",
- title = "Communication in the Presence of Noise",
- year = "1949",
- journal = "Proc. IRE",
- volume = "37",
- pages = "10-21"}
-
- # For the committed: The Complete Works!
-
- @inproceedings{Shannon1993,
- author = "C. E. Shannon",
- editor = "N. J. A. Sloane and A. D. Wyner",
- booktitle = "Claude Elwood Shannon: Collected Papers",
- publisher = "IEEE Press",
- address = "Piscataway, NJ",
- isbn = "0-7803-0434-9",
- comment = "IEEE Order Number: PC0331-9
- To order directly by charge card (eg Visa works) you can call
- (908)-981-0060
- $69.95 + $5 handling charge
- delivery in about 2 weeks",
- price = "price as of 1994 October 31: \$69.95",
- year = "1993"}
-
- # How locks work and other cool stuff:
-
- @book{Macaulay1988,
- author = "D. Macaulay",
- title = "The Way Things Work",
- publisher = "Houghton Mifflin Company",
- address = "Boston",
- isbn = "0-395-42857-2",
- price = "price as of 1994 October 31: \$29.95",
- comment = "This book is also available on Windows-Compatible CD-ROM
- cdrom isbn = 1-56458-901-3 Price as of 1994 October 31: \$99.95",
- year = "1988"}
-
- # Leff1990 gives a review of the Maxwell's Demon problem.
- # See also Schneider.edmm, listed below.
-
- @book{Leff1990,
- author = "H. S. Leff and A. F. Rex",
- title = "Maxwell's Demon: Entropy, Information, Computing",
- publisher = "Princeton University Press",
- address = "Princeton, N. J.",
- phone = "1(800) 777-4726",
- isbn.hard = "0-691-08726-1 (hard cover)",
- price.hard = "price as of 1994 October 31: \$80.00",
- isbn.paper = "0-691-08727-X (paperback)",
- price.paper = "price as of 1994 October 31: \$26.95",
- year = "1990"}
-
- # ***********************************************************
-
- # REFERENCES - Jaynes
-
- @article{JaynesI,
- author = "Edwin T. Jaynes",
- title = "Information Theory and Statistical Mechanics",
- year = 1957,
- journal = "Physical Review",
- volume = "106",
- pages = "620-630"}
-
- @article{JaynesII,
- author = "Edwin T. Jaynes",
- title = "Information Theory and Statistical Mechanics. {II}",
- year = 1957,
- journal = "Physical Review",
- volume = "108",
- pages = "171-190"}
-
- # A version of Jaynes' new book "PROBABILITY THEORY -- THE LOGIC OF SCIENCE"
- # is available on the net. See:
- #
- # ftp://bayes.wustl.edu/Jaynes.book/
- # Larry Bretthorst (larry@bayes.wustl.edu)
- #
- # http://omega.albany.edu:8008/JaynesBook.html
- # Carlos Rodriguez (carlos@math.albany.edu)
- #
- # Tom Schneider's pointers to these places:
- # http://www-lmmb.ncifcrf.gov/~toms/jaynes.html
- #
- # Note: The book is being written now and new versions come out every once in a
- # while. One of these locations may be more up to date than the other.
-
- # ***********************************************************
- # REFERENCES - Schneider
-
- @article{Schneider1986,
- author = "T. D. Schneider
- and G. D. Stormo
- and L. Gold
- and A. Ehrenfeucht",
- title = "Information content of binding sites on nucleotide sequences",
- journal = "J. Mol. Biol.",
- volume = "188",
- pages = "415-431",
- year = "1986"}
-
- @inproceedings{Schneider1988,
- author = "T. D. Schneider",
- editor = "G. J. Erickson and C. R. Smith",
- title = "Information and entropy of patterns in genetic switches",
- booktitle = "Maximum-Entropy and Bayesian Methods in Science and Engineering",
- volume = "2",
- pages = "147-154",
- publisher = "Kluwer Academic Publishers",
- address = "Dordrecht, The Netherlands",
- year = "1988"}
-
- @article{Schneider1989,
- author = "T. D. Schneider
- and G. D. Stormo",
- title = "Excess Information at Bacteriophage {T7} Genomic Promoters
- Detected by a Random Cloning Technique",
- year = "1989",
- journal = "Nucl. Acids Res.",
- volume = "17",
- pages = "659-674"}
-
- @article{Schneider.Stephens.Logo,
- author = "T. D. Schneider
- and R. M. Stephens",
- title = "Sequence Logos: A New Way to Display Consensus Sequences",
- journal = "Nucl. Acids Res.",
- volume = "18",
- pages = "6097-6100",
- year = "1990"}
-
- @article{Schneider.ccmm,
- author = "T. D. Schneider",
- title = "Theory of Molecular Machines.
- {I. Channel} Capacity of Molecular Machines",
- journal = "J. Theor. Biol.",
- volume = "148",
- number = "1",
- pages = "83-123",
- note = "{(Note: The figures were printed out of order!
- Fig. 1 is on p. 97.)}",
- year = 1991}
-
- @article{Schneider.edmm,
- author = "T. D. Schneider",
- title = "Theory of Molecular Machines.
- {II. Energy} Dissipation from Molecular Machines",
- journal = "J. Theor. Biol.",
- volume = "148",
- number = "1",
- pages = "125-137",
- year = 1991}
-
- @article{Herman.Schneider1992,
- author = "N. D. Herman
- and T. D. Schneider",
- title = "High Information Conservation Implies that at Least Three Proteins
- Bind Independently to {F} Plasmid {{\em incD\/}} Repeats",
- journal = "J. Bact.",
- volume = "174",
- pages = "3558-3560",
- year = "1992"}
-
- @article{Stephens.Schneider.Splice,
- author = "R. M. Stephens
- and T. D. Schneider",
- title = "Features of spliceosome evolution and function
- inferred from an analysis of the information at human splice sites",
- journal = "J. Mol. Biol.",
- volume = "228",
- pages = "1124-1136",
- year = "1992"}
-
- @article{Papp.helixrepa,
- author = "P. P. Papp
- and D. K. Chattoraj
- and T. D. Schneider",
- title = "Information Analysis of Sequences that Bind
- the Replication Initiator {RepA}",
- journal = "J. Mol. Biol.",
- comment = "Cover of 233, number 2!",
- volume = "233",
- pages = "219-230",
- year = "1993"}
-
- @article{Schneider.nano2,
- author = "T. D. Schneider",
- title = "Sequence Logos, Machine/Channel Capacity,
- {Maxwell}'s Demon, and Molecular Computers:
- a Review of the Theory of Molecular Machines",
- journal = "Nanotechnology",
- volume = "5",
- number = "1",
- pages = "1-18",
- year = "1994"}
- ftp://ftp.ncifcrf.gov/pub/delila/nano2.ps
-
- # ***********************************************************
- # REFERENCES - Yockey
-
- @book{Yockey1958a,
- editor = "Hubert P. Yockey and Robert P. Platzman and Henry Quastler",
- title = "Symposium on Information Theory in Biology",
- booktitle = "Symposium on Information Theory in Biology",
- publisher = "Pergamon Press",
- address = "New York, London",
- comment = "out of print",
- year = "1958"}
-
- @article{Yockey1981,
- author = "Hubert P. Yockey",
- year = 1981,
- title = "Self-organization Origin of Life Scenarios and Information Theory",
- journal = "J. Theor. Biol.",
- volume = "91",
- pages = "13-31"}
-
- @book{Yockey1992,
- author = "H. P. Yockey",
- title = "Information Theory in Molecular Biology",
- publisher = "Cambridge University Press",
- address = "Cambridge",
- isbn = "0-521-35005-0",
- comment = "40 West 20th Street,
- New York, N. Y. 10011-4211,
- order number 350050",
- phone = "1-800-827-7423",
- price = "price as of 1994 October 31: \$74.95",
- year = "1992"}
-
- Following is Hubert Yockey's reference list:
-
- Yockey, Hubert P. Information Theory and Molecular Biology, Cambridge UK:
- Cambridge University Press (1992)
- When is random random? Nature 344 (1990) p823, Hubert P. Yockey
- Yockey, Hubert P. (1981). Self-organization origin of life scenarios and
- information theory. Journal of Theoretical Biology, 91, 13-31.
- Yockey, Hubert P. (1979). Do overlapping genes violoate molecular biology and
- the theory of evolution? Journal of Theoretical Biology, 80, 21-26.
- Yockey, Hubert P. (1978). Can the Central Dogma be derived from information
- theory? Journal of Theoretical Biology, 74, 149-152.
- Yockey, Hubert P. (1977a). A prescription which predicts functionally
- equivalent residues at given sites in protein sequences. 67, 337-343.
- Yockey, Hubert P. (1977b). On the information content of cytochrome c.
- Journal of Theoretical Biology, 67, 345-376.
- Yockey, Hubert P. (1977c). A calculation of the probability of spontaneous
- biogenesis by information theory. Journal of Theoretical Biology, 67,
- 377-398.
- Yockey, Hubert P (1974). An application of information theory to the Central
- Dogma and the sequence hypothesis. Journal of Theoretical Biology,.46,
- 369-406.
- Yockey, Hubert P. (1960) The Use of Information Theory in Aging and Radiation
- Damage In The Biology of Aging American Institute of Biological Sciences
- Symposium No. 6 (160) pp338-347
- Yockey, Hubert P., Platzman, Robert P. & Quastler, Henry, eds. (1958a).
- Symposium on Information Theory in Biology, New York, London: Pergamon Press.
- Yockey, Hubert P. (1958b). A study of aging, thermal killing and radiation
- damage by information theory. In Symposium on Information Theory in Biology.
- eds. Hubert P. Yockey, Robert Platzman & Henry Quastler, pp297-316. New York,
- London: Pergamon Press.
- Yockey, Hubert P. (1956). An application of information theory to the physics
- of tissue damage. Radiation.Research, 5, 146-155.
-
- ***********************************************************
-
- |-| Will Authors Send Me Papers?
-
- Tom Schneider will mail you copies of his papers. Send your physical address
- to him at toms@ncifcrf.gov. Some papers are on line already, see also the
- README file in the ftp archive ftp.ncifcrf.gov in pub/delila.
-
- If you are willing to send out papers or have papers you would like listed
- here, please contact Tom Schneider.
-
- You can request them by Mosaic from the page
- http://www-lmmb.ncifcrf.gov/~toms/papers.html
-
- ***********************************************************
-
- |-| How Do I find Sequence Logos on the Web?
-
- http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html
-
- ***********************************************************
-
- |-| Is There a Shell Script for Making Sequence Logos?
-
- Yes, you will find the one Shmuel Pietrokovski wrote in the ftp archive
- ftp.ncifcrf.gov in pub/delila/logoaid. (Also available in
- bioinformatics.weizmann.ac.il/pub/software/logoaid.)
- ***********************************************************
-
- |-| Is There a Mosaic Page for Making Sequence Logos?
-
- Yes, Steve Brenner has done it!
-
- http://www.bio.cam.ac.uk/seqlogo/
-
- ***********************************************************
-
- |-| Can You Just Point My Mosaic To The FAQ and the Archives?
-
- This file and the postings may be obtained by Mosaic through the world wide web
- at:
-
- <UL>
-
- <H2>
- <LI> <A HREF="ftp://ftp.ncifcrf.gov/pub/delila/bionet.info-theory.faq.Z">
- FAQ (Frequently Asked Questions)</A>
- about the Biological Information Theory and Chowder Society
- </H2>
-
- <H2>
- <LI> <A HREF="gopher://net.bio.net/11/BIO-INFO">
- Gopher Link to Archive of All Postings.</A>
- This archive contains the most recent postings
- as separate documents.</H2>
-
- <H2>
- <LI> <A HREF="ftp://net.bio.net/pub/BIOSCI/BIO-INFO">
- Archive of Monthly Postings.</A>
- This archive (currently) contains postings
- from each month as a single document.</H2>
-
- <H2>
- <LI> <A HREF="ftp://ftp.bio.indiana.edu/usenet/bionet/info-theory/">
- Gopher link to Archive of Postings at IUBO.</A>
- This archive contains individual postings.
- Older postings are collected by the month as a single document.
- There is an index for each month.
- </H2>
-
- </UL>
-
- ***********************************************************
-
- |-| How Do I obtain bionet.info-theory BY EMAIL?
-
- If you have access to USENET news YOU DO NOT NEED AN E-MAIL SUBSCRIPTION!! We
- strongly encourage all interested users to explore getting USENET news at your
- site. It's MUCH easier on you than an e-mail subscription! Please consult
- your systems manager or contact biosci-help@net.bio.net for assistance if
- needed.
-
- The BIOSCI (email) name for the forum is BIO-INFO.
-
- Depending on where you are, you have to do different things to subscribe or be
- removed from the email subscription list:
-
- SUBSCRIBING / UNSUBSCRIBING
- North or South America or Pacific Rim:
- Using the computer account in which you want to receive mail
- messages, please send an email message to the e-mail server at
- biosci-server@net.bio.net. Leave the Subject: line blank.
- In the body of the message include the line
-
- subscribe bio-info
-
- to add yourself to the mailing list or
-
- unsubscribe bio-info
-
- to cancel an existing subscription. If you need personal
- subscription assistance, please contact biosci-help@net.bio.net.
-
- Europe, Africa, and Central Asia:
- Send a email message to the person at
- biosci@daresbury.ac.uk
- requesting a subscription or removal from the BIO-INFO forum.
-
- SENDING OUT POSTINGS
- Thereafter, address email messages for this forum to one of:
-
- North or South America or Pacific Rim:
- bio-info@net.bio.net
-
- Europe, Africa, and Central Asia:
- bio-info@daresbury.ac.uk
-
- You can post to either of the above address if you want. We only request that
- you sign up at your local node in order to optimize the use of the network
- resources for message distribution.
-
- Do not send subscription requests to any of these addresses, or you will have
- sent it to everybody on the planet (to your great embarrassment, and we will
- drub you with food cake)! Let me say that again: please do not post requests
- for subscription or being removed from the list to the list itself, that takes
- up bandwidth all over the world!
-
- If you have problems, contact the subscription site manager who you signed up
- with. If your problem is not resolved, please contact
- biosci-help@net.bio.net.
-
- DO NOT CONTACT TOM SCHNEIDER FOR SUBSCRIPTIONS OR UNSUBSCRIBING!
-
- ***********************************************************
-
- |-| Where Did I Get This FAQ File From Originally?
-
- The latest version of this FAQ is stored in the anonymous ftp archive
- ftp.ncifcrf.gov in pub/delila under the name bionet.info-theory.faq and also as
- bionet.info-theory.faq.Z (The .Z means it is compressed; remember to use the
- binary transfer mode if you pick up the latter. See the uncompressed README
- file in the archive for where to get the uncompress program if you need it.)
- Please send questions and comments to: Tom Schneider toms@ncifcrf.gov
-
- This file is also posted monthly on news.answers and bionet.info-theory.
-
- ***********************************************************
-
- |-| What is the IP number of the FAQ archive?
-
- For ftp.ncifcrf.gov you can use 129.43.1.11
-
- ***********************************************************
- |-| Where Are the Bionet Archives?
-
- The entire collection of BIOSCI/bionet messages from inception are
- available via the biosci.src WAIS source at net.bio.net. Contact
- biosci-help@net.bio.net for further help with accessing this WAIS source.
-
- FTP archives of all the BIOSCI/bionet messages are available at net.bio.net
- [134.172.2.69] in /pub/BIOSCI. bionet.info-theory is in pub/BIOSCI/BIO-INFO.
- Files are in mailbox format, with names of the form YYMM (YY=last 2 digits of
- the year, MM=cardinal number of the month, zero padded). The current months
- postings are in the file 'current'. Contact biosci-help@net.bio.net for
- further help with or comments on the archives.
-
- All the bionet.* newsgroups, including info-theory, are also archived for
- Gopher retrieval from the IUBIO Gopher hole and for anonymous ftp from
- ftp.bio.indiana.edu, directory usenet/bionet/...
-
- The archives can be accessed by gopher or ftp running under the Mosaic
- interface. The URL (Universal Record Locator) for gopher is:
- gopher://net.bio.net/11/BIO-INFO
- This gives individual postings. By ftp one can use:
- ftp://net.bio.net/pub/BIOSCI/BIO-INFO
- Unfortunately this gives the entire month in a single document.
-
- ***********************************************************
-
- |-| What Can I Do About Inappropriate Postings?
-
- The short form of this news group's name, bio-info, can be a little confusing
- to some people inexperienced in network communications or with little knowledge
- of the discipline (if there is any :-) of biological information theory. It
- can and has been mistaken as a news group for general biological information.
- Our readers should be aware that when such postings come to our attention, we
- do attempt to inform, privately, the people who make these inappropriate
- postings of the error of their ways and suggest alternative or more appropriate
- venues.
-
- Subjecting the writers of inappropriate posting to public excoriation is not a
- good policy because the mistake is usually inadvertent and the follow-up
- postings add further to the irritation of our regular readers. When others
- publicly reply to such posts in this news group, although they may think they
- are being polite to the original poster, they are still annoying our regular
- readers. We suggest that a better policy for readers who do wish to reply to
- inappropriate posts is to do so privately or to an appropriate news group.
-
- For further information about how to deal with intransigent netidiots, see:
- http://math-www.uni-paderborn.de/~axel/blacklist.html
-
- ***********************************************************
-
- |-| What is the official word on copyright of this FAQ?
-
- This FAQ fits the description in the U. S. Copyright Act of a "United States
- Government work". It was written as a part of my official duties as Government
- employee. This means it cannot be copyrighted. The article is freely
- available without a copyright notice, and there are no restrictions on its use,
- now or subsequently. I retain no rights in the FAQ.
-
- Thomas D. Schneider
-
- ***********************************************************
-
- |-| Who Takes Care of This Group?
-
- John S. Garavelli
- Protein Information Resource
- National Biomedical Research Foundation
- Washington, DC 20007
- garavelli@gunbrf.bitnet
-
- Tom Schneider
- National Cancer Institute
- Laboratory of Mathematical Biology
- Frederick, Maryland 21702-1201
- toms@ncifcrf.gov
-
- John L. Spouge
- National Center for Biotechnology Information
- National Library of Medicine
- Bethesda, MD 20894
- spouge@frodo.nlm.nih.gov
-
- Please email comments and suggestions on this faq sheet to Tom.
-
- John Garavelli (who also answers to "Steve" if you want to avoid confusion)
- often organizes dinner speakers.
-
- John Spouge often arranges dinner locations.
-
- ***********************************************************
-